4-Aminopyridine Restores Impaired Hypoxic Pulmonary Vasoconstriction in Endotoxemic Mice

All animal experiments were conducted under protocols approved by the governmental animal care committee of Baden-Württemberg, Germany. Male C57BL/6 mice were obtained from RCC Ltd. (Füllinsdorf, Switzerland).

Male mice (body weight 20–35 g) received a lethal intraperitoneal injection of 200 mg/kg body weight pentobarbital sodium (Narcoren; Merial GmbH, Hallbergmoos, Germany) and were placed in a 37°C water-jacketed chamber (Isolated perfused lung size I; Hugo-Sachs-Elektronik, March-Hugstetten, Germany). After tracheostomy, volume-controlled ventilation (MiniVent 845; Hugo-Sachs-Elektronik) was initiated with a tidal volume of 10 ml/kg body weight, a positive end-expiratory pressure of 2 cm H²O, and a respiratory rate of 90 breaths/min using an inspired gas mixture of 21% O², 5% CO², and 74% N²(Messer Griesheim GmbH, Ludwigshafen, Germany). After right parasternal thoracotomy, lungs were exposed, and a suture was placed around the ascending aorta and the main pulmonary artery. After injection of 10 U heparin into the right ventricle, a stainless steel cannula (1 mm ID) was inserted into the pulmonary artery via  the right ventricle, and the suture was tightened. Another stainless steel cannula (1 mm ID) was advanced into the left atrium via  the apex of the left ventricle across the mitral valve to drain pulmonary venous efflux. Left atrial pressure was maintained at 2 mm Hg. Lungs were perfused at a constant flow of 50 ml · kg body weight⁻¹· min⁻¹using a roller pump (Ismatec Laboratoriumstechnik GmbH, Wertheim-Monfeld, Germany) in a nonrecirculating system at 37°C. Perfusate flow was adjusted using a small vessel flow probe connected to a flowmeter (T106; Transonic Systems Inc., Ithaca, NY). The perfusate used was a Hanks’ Balanced Salt Solution (Life Technologies Ltd., Paisley, Scotland) with 5% bovine serum albumin (Serva, Heidelberg, Germany) and 5% dextran (Sigma-Aldrich Chemie GmbH, Deisenhofen, Germany) added to prevent pulmonary edema.13,14Indomethacin, 30 mm (Sigma-Aldrich Chemie GmbH), and 1 mm of the nonselective nitric oxide synthase inhibitor N  ^G-nitro-l-arginine methylester (Sigma-Aldrich Chemie GmbH) were added to the perfusate to inhibit endogenous prostaglandin and nitric oxide synthesis, respectively.13,14The partial pressure of oxygen of the perfusate was measured before and immediately after each experiment during normoxic ventilation and was found to range between 120 and 155 mm Hg. Pilot experiments revealed that variations in partial pressure of oxygen within this range do not affect subsequent pulmonary vasoconstrictor responses to hypoxia. Lungs were included in this study if perfusion pressure was stable and below 10 mm Hg during the first 5 min of an initial 10-min baseline perfusion period and if lungs had a homogenous white appearance with no signs of atelectasis, hemostasis, or edema. Because of these criteria, approximately 15% of lung preparations in each group were discarded before further measurements.

Pulmonary artery pressure (PAP) and left atrial pressure were measured using saline-filled membrane pressure transducers (Medex Medical GmbH & Co KG, Klein-Winterheim, Germany) connected to a side port of the inflow and outflow cannula, respectively. Pressure transducers as well as the flowmeter were connected to a transbridge amplifier (TBM4M; World Precision Instruments, Berlin, Germany). Data were recorded at 150 Hz per channel on a personal computer using an analog-to-digital interface and a data acquisition software system (DI-220/222; Dataq Instruments, Akron, OH). The system was calibrated before each experiment.

An original recording of a typical experiment is shown in figure 1. After an initial 10-min baseline perfusion period, lungs were perfused with a flow of 25, 50, 75, and 100 ml · kg body weight⁻¹· min⁻¹in randomized order for 30 s each to generate a four-point pressure–flow (P-Q) curve under normoxic conditions. At each flow step, left atrial pressure was readjusted to 2 mm Hg, and PAP was measured at the end of each period. Then, flow was set to 50 ml · kg body weight⁻¹· min⁻¹, and, after another 3 min of baseline perfusion, the lungs were ventilated with a hypoxic gas mixture containing 1% O², 5% CO², and 94% N²(Messer Griesheim GmbH). Pilot experiments (n = 5) revealed that the maximal hypoxic pressure response was reached between 5 and 7 min followed by a slow decline in PAP (data not shown). Therefore, the hypoxic pulmonary vasoconstrictor response (ΔPAP) was defined as the increase in PAP 6 min after initiation of hypoxic ventilation in percent of baseline PAP. Then, a second P-Q curve was generated during hypoxia as described above. Finally, perfusate flow was reset to 50 ml · kg body weight⁻¹· min⁻¹, normoxic ventilation was reestablished, and PAP was allowed to return to baseline values. In all experiments, perfusion pressure at the end of the experiment did not differ from baseline pressure by more than 20%.

The resulting four-point P-Q curves generated during normoxic and hypoxic ventilation for each experiment were analyzed (Statistica for Windows; StatSoft Inc., Tulsa, OK) based on the distensible vessel model of Linehan et al.  24According to this model, the properties of the pulmonary circulation consist of a “static” component (R⁰, intrinsic vascular resistance) and a “dynamic” component (α, vessel distensibility).13Linehan et al.  used the following nonlinear regression analysis of the general form (see Linehan et al. ,24equation 12)

where R⁰describes the pulmonary vascular resistance that would exist if the vessels were at their respective diameter at zero vascular pressure, and α is the vascular “distensibility factor” describing the relation between vessel diameter and pressure (P) when the diameter (Dⁱ ) is normalized to the diameter at zero pressure (D⁰ⁱ ) given by (equation 5 in Linehan et al.  24)

LAP is the mean left atrial (outflow) pressure, which in our analysis was set to 2 mm Hg.

We decided to use this nonlinear regression model rather than the more often used linear regression analysis based on the collapsible vessel model (ohmic-Starling resistor model) of Permutt and Riley,25because several limitations in interpreting linear regression parameters (slope and intercept of the linear regression line) have been raised.26,27In a recent study,13we were able to demonstrate a differential modulation of the HPV response by nitric oxide synthase isoform-specific endogenous nitric oxide production only because we used the nonlinear regression analysis according to Linehan et al.  24 

Mice were injected intraperitoneally with 20 mg/kg Escherichia coli  0111:B4 lipopolysaccharide (Difco Laboratories, Detroit, MI) dissolved in saline 18 h before lung perfusion experiments. Untreated mice served as controls.

To study the role of Kv  channels in lipopolysaccharide-induced impairment of HPV, lungs obtained from lipopolysaccharide-treated and untreated control mice were perfused with the Kv  channel specific inhibitor 4-AP (Sigma Aldrich GmbH) added to the perfusate at doses of 0.01, 0.1, and 1.0 mm, respectively.28–31Resulting data for ΔPAP and P-Q relations were compared with data obtained in untreated and lipopolysaccharide-treated mice in the absence of 4-AP (total of eight groups with n = 7 each).

We further investigated whether 4-AP specifically augments HPV or rather acts as a nonspecific modulator of pulmonary vascular responsiveness during endotoxemia. Therefore, we studied the pulmonary vasoconstrictor response to angiotensin II in lungs of untreated and lipopolysaccharide-treated mice with and without addition of 1 mm 4-AP to the perfusate (n = 7 per group). After 10 min of baseline perfusion, three doses of angiotensin II (0.01, 0.1, and 1 μg) were consecutively injected into the perfusion line proximal to the roller pump in a randomized order. After each injection, 10 min of perfusion was allowed for PAP to return to baseline. The vasoconstrictor response (ΔPAP) to angiotensin II was measured as the maximal increase of PAP in percent of baseline PAP.

To study potential mechanisms underlying 4-AP–induced effects on HPV in lipopolysaccharide-treated mice, we analyzed up-regulation of 4-AP and oxygen-sensitive Kv  channels, such as Kv  1.2, Kv  1.5, Kv  2.1, and Kv  3.128,32–34in lipopolysaccharide-treated versus  control mice by reverse-transcriptase polymerase chain reaction (PCR).

RNA was isolated from mouse lungs using the Trizol reagent (Invitrogen Life Technologies, Carlsbad, CA), and complementary DNA was generated with MMLV reverse transcriptase (Promega, Madison, WI) and random primers (Promega, Madison, WI). Quantitative reverse-transcriptase PCR was performed with the ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) using specific primers for Kv  1.2 (TGCGGTTCGAAACTCAGCTAA, GCGGTTGCGATCAAAAAAGTAC), Kv  1.5 (TCT-TTTCCCCCGTTACCCTT, TGCGTCATGGAATGCGATA), Kv  2.1 (AGTTCCATGAAGACCCACAACC, GAGGATCGTGA-TACAAGCCCA), Kv  3.1 (CTTTGCCTCCCTCTTCTTCATC, CG-TTCTCGATTTCGGTCTTGTT), and SYBR® Green PCR Master Mix (Applied Biosystems). Postamplification dissociation curves were performed to verify the presence of a single amplification product in the absence of DNA contamination. 18S ribosomal RNA was detected with 18S VIC MGB primers (Applied Biosystems) and Taqman® Universal PCR Master Mix (Applied Biosystems). Changes in Kv  channel gene expression were determined using the Ct method with normalization 18S ribosomal RNA.

At the end of all experiments, lungs were excised without hilar structures and immediately weighed. Thereafter, lungs were dried in an oven at 100°C overnight and then reweighed. Lung wet-to-dry weight ratios were calculated as described previously.14 

Nonlinear regression analysis was performed for P-Q data obtained under normoxic and hypoxic conditions to yield α and R⁰values for each single experiment, respectively. All data are expressed as mean ± SD. To compare groups, a two-way analysis of variance followed by a post hoc  least significant difference test for planned comparisons was performed (Statistica for Windows). Statistical significance was assumed at P < 0.05.

Eighteen hours after lipopolysaccharide injection, mice showed lethargy, piloerection, and diarrhea. The mortality rate was approximately 10% at 18 h after lipopolysaccharide injection. Lung wet-to-dry weight ratios measured after completion of lung perfusion experiments did not differ between any of the studied groups (data not shown).

Baseline perfusion pressure under normoxic ventilation did not differ between lipopolysaccharide-pretreated and untreated mice (table 1). However, nonlinear regression analysis revealed that lipopolysaccharide treatment caused a significant increase in intrinsic vascular resistance (R⁰) that was accompanied by an increase in vessel distensibility (α) (fig. 2).

As described previously,13ventilation of lungs of untreated mice with a hypoxic gas mixture increased PAP by 10.1 ± 3.2 mm Hg (ΔPAP 134 ± 37%; P < 0.001; fig. 3), which was associated with an increase in intrinsic resistance R⁰(i.e. , a decrease in total pulmonary vessel diameter at zero pressure), whereas vessel distensibility (α) did not change from baseline (fig. 2). In contrast, the hypoxia-induced ΔPAP was markedly reduced in lungs of lipopolysaccharide-pretreated mice (26 ± 27%; P < 0.001 vs.  untreated control; fig. 3). This lipopolysaccharide-induced reduction in the vasoconstrictor response to hypoxia was attributable to a completely abolished increase in R⁰(fig. 2A).

In untreated control mice, inhibition of Kv  channels by 4-AP at doses of 0.01, 0.1, and 1.0 mm did not affect baseline PAP (table 1) or any of the parameters describing the pulmonary vascular P-Q relation (fig. 2) under normoxic conditions.

In contrast, in lipopolysaccharide-challenged mice, 4-AP restored the changes in pulmonary vascular P-Q relation observed during normoxic conditions: Intrinsic vascular resistance (R⁰) was reduced by 4-AP to values comparable to those measured in untreated control mice (fig. 2A). Moreover, the observed lipopolysaccharide-induced increase in vessel distensibility (α) under normoxic resting conditions was abolished by perfusion with 4-AP (fig. 2B). These effects of 4-AP were only detectable by analyzing pulmonary vascular P-Q relations because baseline perfusion pressures (PAP) did not differ significantly between isolated lungs of lipopolysaccharide-treated animals perfused with or without 4-AP (table 1).

The magnitude of the pulmonary vascular response to 1% oxygen (ΔPAP) was not affected by 4-AP in untreated control mice (fig. 3). However, vessel distensibility (α) was lower during hypoxic ventilation in lungs of control animals perfused with 4-AP as compared with lungs without the Kv  channel inhibitor (fig. 2B).

4-Aminopyridine augmented the hypoxia-induced ΔPAP in lipopolysaccharide-challenged mice in a dose-dependent manner (fig. 3). At the highest concentration of 4-AP (1 mm), ΔPAP in response to hypoxia did not differ between lungs isolated from untreated and lipopolysaccharide-treated mice. This effect of 4-AP on HPV was associated with a dose-dependent restoration of the hypoxia-induced change in R⁰in endotoxemic mice (ΔR⁰: −0.64 ± 0.81 mm Hg · ml⁻¹· kg⁻¹· min⁻¹without 4-AP vs.  0.11 ± 0.07, 0.36 ± 0.40, and 0.69 ± 0.83 mm Hg · ml⁻¹· kg⁻¹· min⁻¹with 0.01, 0.1, and 1.0 mm 4-AP, respectively; P < 0.05 for 0.1 and 1.0 mm 4-AP vs.  without 4-AP). We found low doses of 4-AP (0.01 mm) to decrease vessel distensibility significantly in lipopolysaccharide-pretreated mice under normoxic conditions counteracting the observed lipopolysaccharide-induced distensibility increase, whereas there was no further decrease in distensibility by hypoxic ventilation in lungs perfused with higher concentrations of 4-AP (fig. 2B).

To evaluate whether the ability of 4-AP to restore the pulmonary vascular response in lipopolysaccharide-treated mice is limited to hypoxia, we measured the pulmonary vasoconstrictor response (ΔPAP) to boluses of 0.01, 0.1, and 1.0 μg angiotensin II with and without 1.0 mm 4-AP added to the perfusate in lungs of untreated and lipopolysaccharide-challenged mice. Angiotensin II caused a dose-dependent vasoconstriction that was significantly reduced by lipopolysaccharide pretreatment (fig. 4A). In contrast to HPV, perfusion of lungs with 4-AP augmented the vasoconstrictor response to angiotensin II in lungs of both lipopolysaccharide-treated and untreated animals, whereas the difference between lipopolysaccharide-treated and control mice in the vasoconstrictor response to 0.1 and 1.0 μg angiotensin II persisted (fig. 4B).

Several Kv  channel subtypes, namely Kv  1.2, Kv  1.5, Kv  2.1, and Kv  3.1, have been shown to be oxygen sensitive and have been proposed to play a key role in mediating HPV. To test whether up-regulation of these Kv  channels during endotoxemia may account for (1) the reduced HPV response and (2) the above demonstrated augmentation of HPV responsiveness by 4-AP, we analyzed Kv  channel expression on the messenger RNA (mRNA) level. As shown in figure 5, expression of Kv  1.5, Kv  2.1, and Kv  3.1 mRNA did not differ between untreated and lipopolysaccharide-treated mouse groups. We only found a significant reduction in total lung mRNA expression of Kv  channel subtype Kv  1.2 in lungs from lipopolysaccharide-pretreated mice as compared with untreated controls.

The main finding of this study is that impaired pulmonary vasoconstrictor responsiveness to hypoxia (HPV) induced by lipopolysaccharide-treatment in mice can be augmented, and ultimately fully restored, by the Kv  channel inhibitor 4-AP. Our results suggest that 4-AP (1) augments Kv  channel sensitivity to hypoxia in endotoxemic mice and (2) counteracts lipopolysaccharide-induced changes in pulmonary vascular wall properties.

Inhibition of Kv  channels by 4-AP has been shown to depolarize rat pulmonary artery smooth muscle cells and to constrict isolated pulmonary arteries.35Barman et al.  30showed a small increase in perfusion pressure by 4-AP in isolated blood-perfused rat lungs, which was also evident as a trend in the current study, yet without reaching significance (table 1). Hasunuma et al.  reported 4-AP to augment HPV in salt-perfused rat lungs.36In our study in isolated buffer-perfused lungs, 4-AP augmented HPV in lipopolysaccharide-treated mice (fig. 3). That 4-AP did not affect the magnitude of hypoxia-induced pressure response in untreated mice may be due to an already maximal vasoconstrictor stimulus by ventilating lungs with 1% oxygen. This notion is in accordance with the fact that maximal ΔPAP response to angiotensin II in the presence of 4-AP did not exceed the hypoxic pulmonary pressure response in untreated mice. It is further supported by a study by Littler et al.  37showing that ventilating isolated mouse lungs with 0% oxygen increased perfusion pressure by approximately 6.5 mm Hg starting at a normoxic baseline of 8–12 mm Hg. Consistent with our results (fig. 3), these authors did not find 4-AP to augment the hypoxia-induced increase in perfusion pressure. However, evidence that there was indeed an effect of 4-AP on hypoxic vasoconstriction in control animals in the current study comes from pulmonary vascular P-Q relation analyses revealing significantly lower vessel distensibility (α) and a dose-dependent reduction in intrinsic vascular resistance (R⁰) during hypoxic ventilation in lungs perfused with 4-AP as compared with perfusion without 4-AP (fig. 2B). Further analyses of the pulmonary vascular P-Q relation using the vessel distensibility model24revealed 4-AP to augment HPV in lipopolysaccharide-challenged mice in two ways. First, 4-AP perfusion restored the basal pulmonary vascular properties that were altered by lipopolysaccharide treatment: 4-AP normalized the lipopolysaccharide-induced increase in vessel distensibility α and the lipopolysaccharide-induced decrease in intrinsic vascular resistance R⁰under normoxic baseline conditions (fig. 2). Second, 4-AP in addition augmented the hypoxia-induced change in R⁰in a dose-dependent manner (fig. 2A). These findings cannot be directly attributed to the inhibitory effect of 4-AP on oxygen-sensitive Kv  channels, but rather suggest a sensitization of these channels to subsequent hypoxic stimulation. A potential mechanism underlying this unexpected finding may be that the effects of 4-AP under normoxic conditions in lipopolysaccharide-challenged mice are due to inhibition of non–oxygen-sensitive Kv  channels, which then “sensitizes” the pulmonary vasculature for a vasoconstrictor stimuli. This is further supported by our finding that these effects of 4-AP were not limited to the hypoxic vasoconstrictor response, but that 4-AP also augmented pulmonary vasoconstriction in response to angiotensin II in both untreated and lipopolysaccharide-treated mice (fig. 4). It should be emphasized that the pulmonary vascular effects of 4-AP under normoxic conditions were only discovered because we studied pulmonary vascular P-Q curves by nonlinear regression analysis rather than only perfusion pressures.

Hypoxic pulmonary vasoconstriction is intrinsic to pulmonary vascular smooth muscle cells. Although the exact mechanism by which low alveolar oxygen tension is sensed by the pulmonary vasculature is still under debate,17–20it is well accepted that modulation of the opening probability of Kv  channels setting vascular smooth muscle membrane potential is central to the effector mechanism of pulmonary vasoconstriction in response to hypoxia.21–23Nine families of Kv  channels have been described, of which multiple subtypes were shown to be present in the pulmonary vasculature in animals18,28,33,38and humans.39Of these subtypes, Kv  1.2, Kv  1.5, Kv  2.1, Kv  3.1, and Kv  9.3 seem to possess oxygen sensitivity.23,40Convincing evidence that Kv  1.5 has a critical role in mediating HPV has come from studies of Kv  1.5-deficient mice34and studies in which Kv  1.5 overexpression restored HPV in chronically hypoxic rats.41Dysfunction or decreased expression of Kv  1.5 and Kv  2.1 in the pulmonary circulation is associated with impaired HPV in rats exposed to chronic hypoxia42or in rats with nitrogen-induced congenital diaphragmatic hernia (Kv  1.2 and Kv  2.1).43Because 4-AP, which is conventionally known to act as a Kv  channel inhibitor, restored HPV responsiveness after lipopolysaccharide it could be speculated that lipopolysaccharide treatment may increase the expression of pulmonary vascular Kv  channels, which will result in an increased threshold for hypoxia-induced smooth muscle membrane depolarization (HPV hyporesponsiveness). Inhibiting these Kv  channels with 4-AP at a dose that alone—as in our model (table 1and fig. 2)—does not induce vasoconstriction may “sensitize” these channels to reach the threshold for membrane depolarization in response to a hypoxic challenge. Yet surprisingly, we did not detect an up-regulation of Kv  channel mRNA expression (fig. 5), especially with regard to subtypes Kv  1.5 and Kv  2.1, which have been previously suggested to be involved in disease-related HPV hyporesponsiveness.34,42Solely mRNA levels of the Kv  1.2 subtype were found to be significantly reduced (and a trend was seen for Kv  2.1) in lungs from lipopolysaccharide-challenged mice as compared with untreated controls (fig. 5). Although this finding may suggest a role of Kv  1.2 and/or Kv  2.1 in lipopolysaccharide-induced HPV hyporesponsiveness during sepsis, reduced channel expression cannot explain the restoration of impaired HPV by 4-AP on the basis of its inhibitory action on Kv  channels. The current data rather suggest that 4-AP restores the impaired HPV response during endotoxemia by “sensitizing” pulmonary vascular Kv  channels to hypoxia by a novel, yet unidentified mechanism.

In summary, we found that 4-AP dose-dependently restored impaired HPV in endotoxemic mice. Impairment of HPV can result in critical hypoxemia due to ventilation–perfusion mismatching in patients with pneumonia, sepsis, or acute respiratory distress syndrome. Restoration of intact HPV by “sensitization” of pulmonary vascular Kv  channels may provide a new therapeutic approach in these patients. 4-AP may present a promising drug in this strategy because it is—also known as fampridine—currently already on the US Food and Drug Administration’s compounding for compassionate use list for treatment of certain neuropathies, spinal cord injury, and multiple sclerosis. The concept of therapeutic pulmonary vasoconstriction for the treatment of hypoxemia due to acute lung injury has been tested before using drugs such as phenylephrine,44norepinephrine,45or almitrine46or their combination with inhaled pulmonary vasodilators,47–49but has not yielded beneficial results so far. A potential reason for this lack in effectiveness of these drugs may be that they induce a generalized increase in pulmonary vascular tone but do not alter the pulmonary vascular sensitivity to subsequent vasoactive stimuli. Here, we demonstrate that 4-AP augmented not only HPV but also the pulmonary vascular response to angiotensin II in endotoxemic mice. Analysis of pulmonary vascular P-Q curves suggests that this may be due to both counteracting the lipopolysaccharide-induced changes in pulmonary vascular properties under normoxic conditions, i.e. , vascular distensibility and basal vascular resistance, and augmenting the vasoconstrictor response. Therefore, 4-AP may “normalize” basal pulmonary vascular tone and pulmonary vascular wall properties during endotoxemia thereby restoring the pulmonary vasculature’s ability to respond to various endogenous or exogenous vasoactive agents.